intTypePromotion=1

BÁO CÁO KHOA HỌC : ĐA HÌNH GEN BF2 VÀ GEN Mx Ở MỘT SỐ GIỐNG GÀ NỘI

Chia sẻ: Nguyen Nhi | Ngày: | Loại File: PDF | Số trang:8

0
87
lượt xem
9
download

BÁO CÁO KHOA HỌC : ĐA HÌNH GEN BF2 VÀ GEN Mx Ở MỘT SỐ GIỐNG GÀ NỘI

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Chăn nuôi phát triển bền vững, bên cạnh việc ứng dụng các tiến bộ kỹ thuật về chăn nuôi và thú y vào sản xuất, thì việc chọn lọc các giống có khả năng kháng bệnh đang là vấn đề quan tâm của các nhà khoa học trên thế giới. Các gen MHC mã hoá glycoprotein bề mặt tế bào có khả năng kháng bệnh đã được nghiên cứu trên các giống vật nuôi nói chung và gia cầm nói riêng. Các gen MHC được các nhà khoa học về giống gia cầm quan tâm nhiều là do chúng có mức độ đa hình cao...

Chủ đề:
Lưu

Nội dung Text: BÁO CÁO KHOA HỌC : ĐA HÌNH GEN BF2 VÀ GEN Mx Ở MỘT SỐ GIỐNG GÀ NỘI

  1. TRẦN XUÂN HOÀN – Đa hình gen BF2 và gen Mx ... ĐA HÌNH GEN BF2 VÀ GEN Mx Ở MỘT SỐ GIỐNG GÀ NỘI Trần Xuân Hoàn*, Phạm Thị Phương Mai, Nguyễn Thị Quỳnh Châu, và Trần Xuân Toàn Phòng Thí nghiệm Trọng điểm tế bào động vật *Tác giả liên hệ : Trần Xuân Hoàn - Phòng thí nghiệm Trọng điểm Công nghệ tế bào động vật Thụy Phương - Từ Liêm - Hà Nội Tel: (04) 22.116.165/0914.873.684; Fax: (04) 38.389.775; Email: hoantranvcn@yahoo.com ABSTRACT The polymorphisms in BF2 gene and Mx gene of some Vietnam native chicken breeds The polymorphisms of Mx gene were investigated in three kinds of the Vietnam native chicken breeds: Tre chicken, H’Mong chicken and Te chicken. The resistant or sensitive antiviral activity Mx allelic gene were identified by using the mismatched PCR-restriction fragment length polymorphism (RFLP) technique. In total, 180 samples of 3 chicken breeds were examined.The rates of the resistant Mx allele and sensitive allele were 50.3% and 49.7%, respectively. A total of 48 chicken, from the Vietnam native breed including 16 Tre chicken and 16 H’mong chickens and 16 Te chicken were studied for the exon 2 polymorphism of the BF2 gene of the major histocompatibility complex (MHC) region. Exon 2 of the BF2 gene was selectively amplified from genomic DNA using BF2 locus-specific PCR primers. The 178 bp long exon 2 sequence was convenient to identify the specific haplotype. Among 16 haplotypes were identified there are 8 specific haplotypes of three native chicken breeds. There is association between B21 allele of BF2 gene and R allele of Mx gene in three native chicken breeds. Key words: polymorphisms; Mx gene; BF2 gene; H’Mong chicken, Tre chicken and Te chicken. ĐẶT VẤN ĐỀ Chăn nuôi phát triển bền vững, b ên cạnh việc ứng dụng các tiến bộ kỹ thuật về chăn nuôi và thú y vào sản xuất, thì việc chọn lọc các giống có khả năng kháng bệnh đang là vấn đề quan tâm của các nhà khoa học trên thế giới. Các gen MHC mã hoá glycoprotein b ề mặt tế bào có khả năng kháng bệnh đ ã đ ược nghiên cứu trên các giống vật nuôi nói chung và gia cầm nói riêng. Các gen MHC được các nhà khoa học về giống gia cầm quan tâm nhiều là do chúng có mức độ đa hình cao và có mối liên kết với những tính trạng kháng bệnh truyền nhiễm của gà. Đa hình gen MHC của gà Bacon (1987) cho rằng, có khả năng kháng hoặc mẫn cảm với các b ệnh về vi khuẩn; ký sing trùng và virus. Macklin và cs, (2002) cho biết, các gen MHC của gà đóng vai trò chính trong tác động nhiễm bệnh Marek. Gà mang alen B13 mẫn cảm với virus gây b ệnh, nhưng mang alen B21 có khả năng kháng virus. Nghiên cứu trên gà ở Trung Quốc, Li và cs, (2006) cho thấy, có mối liên kết đa hình gen MHC với khả năng kháng bệnh truyền nhiễm. Trong khi đó, phân tích đa hình gen MHC nhóm I (BF2) trên các giống gà bản địa của Thái Lan ở hai nhóm gà sống sót và chết do cúm gia cầm, Boonyanuwat và cs (2006) đã phát hiện gà mang kiểu gen dạng đồng hợp tử B21 có tỉ lệ sống là 100%, dạng dị hợp tử B21 cũng có tỉ lệ sống cao. Ngược lại gà mang kiểu gen đồng hợp tử B13 có tỉ lệ chết là 100%. Các tác giả cho rằng, gen MHC có thể sử dụng như chỉ thị phân tử để chọn lọc nâng cao khả năng kháng b ệnh của gà. Ewald và cs, (2006) nghiên cứu trên 3 dòng gà Broiler thương phẩm chỉ ra, đa hình gen BF2 có liên quan đ áng kể với một số tính trạng ở hai d òng. Alen BF2* 21 có mối liên quan dương với lựơng kháng thể của bệnh Gummboro (bursal virus) trong hai dòng gà. Ko và cs, (2002) cho biết gen Mx của một số giống gà có khả năng kháng đ ược virus influenza và VSV (vesicular stomatitis virus). Ko và cs (2004) phân tích gen Mx của gà cho thấy khả năng kháng virus phụ thuộc vào sự sai khác trình tự axit amin ở vị trí 631. Gà mang kiểu gen mã hóa axit amin Asn ở vị trí 631 có khả năng kháng virus, nhưng gà mang kiẻu gen mã hóa Ser ở vị trí 631 mẫn cảm với virus. Seyama và cs (2006) sử dụng kỹ thuật PCR-RFLP 71
  2. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 20-Tháng 10-2008 p hân tích đa hình gen Mx của 36 dòng gà từ 17 giống cho thấy tỷ lệ kiểu gen Mx kháng virus và mẫn cảm tương ứ ng là 59,2% và 40,8%. Li và cs (2006) phân tích gen Mx của 15 giống gà đ ịa phương của Trung Quốc và 4 dòng gà thương phẩm đã chọn lọc cho biết tần số alen kháng virus của các giống bản địa từ 0,72 - 0,95. Trong khi đó tần số alen này của 4 dòng gà thương p hẩm thấp hơn rõ rệt, dao động từ 0,05 - 0,27. Nhưng d o phân bố đ ịa lý, các giống gà nội của chúng ta có thể có quan hệ nguồn gốc gần với các giống gà của Trung Quốc hay Thái Lan, nên khả năng cấu trúc di truyền giữa các giống gà này có mức tương đ ồng nhất định. Do đó, đ ể xác định đ ược mức độ đa hình gen Mx và BF2 của một số giống gà nội sẽ là cơ sở khoa học cho các nghiên cứu tiếp phục vụ việc chọn lọc và lai tạo các giống gà có khả năng kháng b ệnh, góp phần vào việc phát triển chăn nuôi gia cầm bền vững. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU Đối tượng nghiên cứu Đối tượng nghiên cứu là các giống gà Tre, gà H’Mông, gà Tè. Mỗi giống lấy 60 mẫu máu đ ược chóng đông bằng EDTA 0,5 M. Phương pháp nghiên cứu Phương pháp tách chiết ADN: Tách chiết ADN thực hiện theo kít AccuPrep® Genomic ADN Extraction Kit của hãng Bioneer. Phương pháp phân tích đa hình gen Mx: Sử dụng hai cặp mồi có trình tự sau để nhân PCR đoạn gen Mx: Sử dụng 2 cặp mồi Cặp mồi R1: Mồi xuôi: 5 ’ – CCTTCAGCCTGTTTTTCTCCTTTTAGGAA - 3’ Mồi ngược: 5’ - CAGAGGAATCTGATTGCTCAGGCGTGTA - 3’ Cặp mồi S1: Mồi xuôi: 5’- CCTTCAGCCTGTTTTTCTCCTTTTAGGAA - 3’ Mồi ngược: 5’ - CAGAGGAATCTGATTGCTCAGGCGAATA - 3’ Chu trình nhiệt: Giai đoạn 1: Biến tính ADN ở nhiệt độ 94 oC trong 5 phút. Giai đoạn 2: Gồm 3 b ước và lặp 35 chu kỳ. Nhiệt độ và thời gian tương ứng/ b ước như sau: 94 oC trong 30 giây; 60oC trong 30 giây; 72 oC trong 30 giây. Giai đoạn 3: Kéo dài chu ỗi ở nhiệt độ 72 oC trong 5 phút, sau đó chuyển nhiệt độ về 4oC. Sản phẩm PCR của cặp mồi R1 cắt bằng RsaI. Sản phẩm PCR của cặp mồi S1cắt bằng SspI. Sau khi cắt bằng enzym giới hạn, phân lập độ d ài các đo ạn ADN bằng chạy điện di trên thạch agarose 2,5%, hệ đệm 1x TBE, nhuộm bằng Ethidium bromide và soi chụp dưới đ èn UV. Phương pháp giải trình tự gen BF2 Sử dụng cặp mồi do Goto thiết kế năm 2002 để nhân đặc hiệu đoạn ADN trong exon 2 gen BF2 ở gà. Kết quả PCR nhân đoạn ADN có kích thước 178 bp. Mồi xuôi: 5′-GTGGACGGGGAACTCTTC-3 ′ Mồi ngược: 5′-TCTGGTTGTAGCGCCG-3 ′ Chu trình nhiệt Giai đoạn 1: Biến tính ADN ở nhiệt độ 95 oC trong 15 phút. Giai đoạn 2: Gồm 3 b ước và lặp 30 chu kỳ. Nhiệt độ và thời gian tương ứng/bước như sau: 94oC trong 45 giây; 60oC trong 90 giây; 72 oC trong 90 giây. 72
  3. TRẦN XUÂN HOÀN – Đa hình gen BF2 và gen Mx ... Giai đoạn 3: Kéo dài chuỗi ở nhiệt độ 72oC trong 15 phút, sau đó chuyển nhiệt độ về 4oC. Phương pháp tinh sạch sản phẩm PCR Sau khi chạy PCR để nhân đặc hiệu đoạn ADN của exon 2 gen BF2 chúng tôi tiến hành kiểm tra kết quả PCR bằng điện di. Sau đó, các mẫu được tinh sạch theo Purelink™PCR Purification Kit của hãng Invitrogen Phản ứng sequencing: Sản phẩm PCR làm sạch đ ược sử dụng là nguyên liệu cho phản ứng sequencing. Phản ứng sequencing được thực hiện theo BigDye Terminator V3.1 Cycle Sequencing Kit của hãng AB (Applied Biosystem). Phương pháp tinh sạch sau phản ứng sequencing: Tinh sạch sau phản ứng sequencing được thực hiện theo BigDye® XTerminator™- Purification Kit của hãng AB. Giải trình tự trên máy giải trình tự tự động : AB - 3130. Các phương pháp phân tích kết quả giải trình tự Sau khi giải trình tự trên máy AB-3130 thu được các file kết quả, đ ược đọc bởi phần mềm p hân tích trình tự Sequencing Analysis version 5.2.0 và phần mềm Bioedit version 7.0.5.3. Quá trình đọc trình tự sai khác, phân lập haplotype được thực hiện nhờ phần mềm Bioedit, Genetyx - Win version 4.0 và được so sánh với các motif của haplotye chuẩn BF2*04 (Z54324), BF2*06 (Z54330), BF2*12 (Z54329), BF2*14 (Z54315), BF2*15 (Z54316), BF2*19 (Z54360) và BF2*21 (54319) (Wallny 2006) và BA4v (U88299) (Li 1997). Các mẫu có kiểu gen dị hợp tử phát hiện thấy có từ 2 vị trí đỉnh trùng nhau. Tiến hành phân tích đa hình và sai khác của các haplotype phân lập theo phần mềm DnaSP version 4.10.8. KẾT QUẢ VÀ THẢO LUẬN Đa hình gen Mx Sản phẩm PCR đ ược nhân lên từ cặp mồi R1 và S1 là đặc hiệu và đ ều có kích thước như mong đợi 100 bp. Kết quả đ ược thể hiện trên Hình 1. M 1 2 3 4 5 6 7 Hình1: Sản phẩm PCR nhân lên từ cặp mồi R1 và S1 của một số giống gà M: Marker 100 bp. 1; 2; 3: Sản phẩm PCR của cặp mồi R1 của gà Tre, H’Mông,Tè. 4; 5;6;7: sản phẩm PCR của cặp mồi S1 của gà Tre, H’Mông,Tè Hình 1 cho thấy, các sản phẩm PCR là đ ặc hiệu, hoàn toàn phù hợp cho phân tích đa hình tiếp theo b ằng enzym giới hạn RsaI và SspI. Sản phẩm PCR của cặp mồi R1 cắt bằng RsaI thu được 3 kiểu gen tương ứng là: Kiểu RR có một băng tương ứng 100 bp. Kiểu RS có 3 băng tương ứ ng là 100 bp, 73 bp và 27 bp. Tuy nhiên kích thước băng 27 bp là nhỏ nên không nhìn thấy trên sắc đồ điện di. Kiểu SS có 2 b ăng tương ứng là 73 bp và 27 bp (băng 27 bp không nhìn thấy). 73
  4. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 20-Tháng 10-2008 Sản phẩm PCR của cặp mồi S1 cắt bằng SspI thu đư ợc 3 kiểu gen tương ứng là: Kiểu SS có một băng tương ứng 100 bp. Kiểu RS có 3 băng tương ứ ng là 100 bp, 73 bp và 27bp. Kiểu RR có 2 băng tương ứng là 7 3 bp và 27 bp (băng 27 bp không nhìn thấy). Kiểu gen Mx thu được khi phân tích đa hình b ằng enzym RsaI và S spI thể hiện qua Hình 2. M 1 2 3 4 5 6 M Hình 2: Cắt sản phẩm PCR bằng enzym RsaI và SspI M: Marker 100 bp. 1: Kiểu gen RR cắt bằng RsaI, 2: kiểu gen SS cắt bằng RsaI, 3;6: Kiểu gen RS cát bằng RsaI và SspI, 5: Kiểu gen RR cắt bằng SspI Tần số các kiểu gen Mx và tần số alen có khả năng kháng R hoặc mẫn cảm S với virus của các giống gà được trình bày trong Bảng 1. Bảng 1. Tần số kiểu gen và tần số alen của gen Mx ở các giống gà Giống gà Kiểu gen Kiểu gen Kiểu gen Tần số Tần số n. RR RS SS alen R alen S Tre 60 0,22 0,47 0,31 0,45 0,55 H’Mông 60 0,35 0,45 0,20 0,58 0,42 Tè 60 0,10 0,75 0,15 0,48 0,52 Bảng 1 cho thấy, tần số các kiểu gen đồng hợp tử RR có khả năng kháng virus trong 3 qu ần thể gà thì gà H’Mông có tỷ lệ cao nhất (0,35) và thấp nhất là gà Tè (0,10). Trong đó, kiểu gen đồng hợp SS tử mẫn cảm với virus có tần số cao nhất gà Tre (0,31) và thấp nhất ở gà Tè (0,15).T ần số alen R kháng virus cao nhất ở gà H’Mông (0,58) và thấp nhất ở gà Tre (0,45). Tỷ lệ kiểu gen dị hợp tỷ RS ở cả ba quần thể gà là khá lớn dẫn đến tần số alen R kháng virus và alen S mẫn cảm ở các quần thể nghiên cứu gần tương đương. Theo các nghiên cứu trước đ ây, gà có trình tự nucleotid A ở vị trí 2032 sẽ mã hóa axit amin Asn tại vị trí 631 có khả năng kháng virus, nhưng nếu nucleotid G thay thế cho nucleotid A ở vị trí 2032 dẫn đến axit amin Ser thay thế Asn thì gà sẽ mẫn cảm với virus (Ko và cs, 2002; 2004, Seyama và cs, 2006). Kết quả cho thấy, kiểu gen RR có khả năng kháng virus ở cả ba giống gà không cao.Trong khi đó kiểu gen dị hợp tử RS chiếm tỷ lệ cao nhất ở cả 3 giống. Nghiên cứu đa hình gen Mx cho 1 giống từ một quần thể có thể là nguyên nhân chưa phản ánh đầy đủ đặc trưng cho một giống. Sự đa dạng di truyền trong exon 2 gen BF2 Phân tích và đ ọc trình tự nucleotid, chú ng tôi phân lập đ ược 16 haplotye có mặt trong 48 cá thể gà thuộc 3 giống nghiên cứu. Gồm B4, B6, B12, B14, B15, B19, B21, BA4v, A2, A11, A8, A51, A45, A41, A03 và A05. Trong đó, có 8 haplotye là đ ặc trưng của gà Việt Nam là các haplotye kí hiệu (A). Kết quả so sánh trình tự nucleotid 8 haplotye đặc trưng ở gà Việt Nam với các haplotye chuẩn thể hiện Hình 3. Từ 16 haplotype đã được phân lập trong các 74
  5. TRẦN XUÂN HOÀN – Đa hình gen BF2 và gen Mx ... giống gà nghiên cứu, tổ hợp thành số lượng kiểu gen khá lớn. Trong đó, mỗi giống có kiểu gen đ ặc trưng riêng. Hình 3: Trình tự nucleotid trong exon 2 gen BF2 của một số giống gà. Hình 3: Trình tự nucleotid trong exon 2 gen BF2 của một số giống gà. Gà Tè: Qu ần thể gà Tè có 7 haplotype, gồm A11, A45, A51, B4, B6, B21, BA4v. Đã phát hiện được 3 kiểu gen đồng hợp tử là BA4v, A11, A51. Trong đó kiểu gen A11, BA4v, và A51 tương ứng có 6; 3 và 1 cá thể. Phân bố tần số kiểu gen và tần số alen quần thể (Bảng 2). Bảng 2. Tần số kiểu gen và tần số alen trong quần thể gà Tè Alen1 A11 A51 A45 B4 BA4v B6 B21 A11 0,375 0,031 - - - - 0,031 A51 0,031 0,063 - - - 0,031 - A45 - - - - - - 0,031 B4 - - - - 0,063 - - BA4v - - - 0,063 0,188 - - B6 - 0,031 - - - - - B21 0,031 - 0,031 - - - - Tần số alen 0,437 0,125 0,031 0,063 0,251 0,031 0,062 Bảng 2 cho thấy, alen A11 có tần số cao nhất 0,437. Đây có thể là alen đặc trưng của gà Tè. 75
  6. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 20-Tháng 10-2008 Gà Tre: Ở gà Tre có 13 haplotype gồm A2, A11, A8, A03, A05, A51, B4, B6, B12, B14, B15, B19, B21 và BA4v. Trong đó phát hiện 01 cá thể đồng hợp tử kiều gen B14 và 01 cá thể đồng hợp tử kiều gen A11 trong tổng số 16 cá thể. Phân bố tần số kiểu gen và tần số alen của quần thể đ ược trình bày trong Bảng 3. Bảng 3. Tần số kiểu gen và tần số alen trong quần thể gà Tre A2 A11 A51 A03 A05 A8 B4 B6 B12 B14 B15 B21 BA4v Alen - - - - - - - - - - - - 0,031 A2 - 0,063 - - 0,031 - 0,031 - - - - - - A11 - - - - - - - - - 0,031 - - - A51 - - - - 0,031 0,031 - - - - - - - A03 - 0,031 - 0,031 - - - - - - - 0,125 - A05 - - - 0,031 - - - - 0,031 - - - - A8 - 0,031 - - - - - - - - 0,031 - - B4 - - - - - - - - - - - 0,031 - B6 - - - - - 0,031 - - - - - - - B12 - - 0,031 - - - - - - 0,063 - - - B14 - - - - - - 0,031 - - - - - - B15 - - - - 0,125 - - 0,031 - - - - 0,031 B21 0,031 - - - - - - - - - - 0,031 - BA4v Tầnsố Alen 0,031 0,125 0,031 0,062 0,187 0,062 0,062 0,031 0,031 0,094 0,031 0,187 0,031 Bảng 3 cho thấy, alen B21 có tần số cao nhất 0,187 trong quần thể gà Tre. Alen B21 là alen có khả năng kháng bệnh Marek và cúm (Macklin và cs, 2002, Boonyanuwat và cs, 2006). Gà H’Mông: Quần thể gà H’Mông nghiên cứu có 13 haplotype, gồm A2, A11, A45, A41, A05, B4, B6, BA4v, B12, B14, B15, B19, B21. Đã Phát hiện đ ược 5 kiểu gen đồng hợp tử là B6, B14, B21, A41, A45, mỗi kiểu gen đồng hợp tử này chỉ có một cá thể. Phân bố tần số kiểu gen và tần số alen của quần thể trình bày trong Bảng 4. Bảng 4. Tần số kiểu gen và tần số alen trong quần thể gà H’Mông A11 A45 A41 A05 B19 B4 B6 B12 B14 B15 B21 BA4v Alen A2 - - - - - - - - - - - 0,031 - A2 - - - - - 0.031 0,031 - - 0,031 - 0,031 - A11 - - 0,063 - 0,031 0,031 - - 0,031 - - 0,031 - A45 - - - 0,063 - - - - - - - - - A41 - - 0,031 - - - - - - - - - - A05 - 0,031 0,031 - - - - - - - - - - B19 - 0,031 - - - - - - - - - - - B4 - - - - - - - 0,063 - - - - 0,031 B6 - - 0,031 - - - - - - - - - - B12 - 0,031 - - - - - - - 0,063 - - - B14 - - - - - - - - - - - 0,031 - B15 0,031 0,031 0,031 - - - - - - - 0,031 0,063 - B21 BA4v - - - - - - - 0,031 - - - - - Tầnsố alen 0,031 0,124 0,187 0,063 0,031 0,062 0,031 0,094 0,031 0,094 0,031 0,187 0,031 Bảng 4 cho thấy, alen B21 và A45 có tần số cao nhất, cùng bằng 0,187 trong quần thể gà H’Mông. Như vậy gà H’Mông và gà Tre có cùng tần số alen B21 có khả năng kháng virus. 76
  7. TRẦN XUÂN HOÀN – Đa hình gen BF2 và gen Mx ... Kết quả trên cho thấy, sự đa dạng các kiểu gen BF2 của quần thể gà Tè là thấp nhất, trong khi đó mỗi quần thể gà H’Mông và gà Tre đ ều có 13 haplotype. Tuy nhiên sự phân bố các alen và tần số của các alen này trong mỗi quần thể cũng khác nhau. Trong số 8 haplotype đ ặc trưng của 3 giống gà nội, gà Tè chỉ có 3 haplotype A11, A51 và A45, gà H’Mông có 5 haplotype A2, A11, A05, A45, A41, gà Tre có 6 haplotype A2, A11, A03, A05, A8, A41, A51. Haplotype A03, A41 là các haplotype đặc trưng tương ứng của các giống gà Tre và gà H’Mông. Trong 8 haplotype đ ặc trưng của các giống gà nội tần số haplotype A11 là cao nhất ở cả 3 giống gà, tương ứng ở gà Tè là 0,437, ở gà Tre và gà H’Mông là như nhau 0,125. Trong quần thể gà Tre và gà H’Mông tần số các haplotye cao nhất tương ứng là A05 và A45, với cùng tần số là 0,187. Haplotype B21 có khả năng kháng bệnh Marek và cúm gà (Macklin và cs, (2002), Boonyanuwat và cs, (2006) và tương quan dương với lượng kháng thể của bệnh Gummboro bursal virus, Ewald và cs, (2006), ở gà Tre và gà H’Mông có tần số như nhau và cùng bằng 0,187, còn ở gà Tè là thấp nhất 0,062. Trong khi đó haplotype B15 có khả năng kháng b ệnh viêm phổi Bacon (1987) chỉ có ở gà Tre và gà H’Mông với cùng tần số là 0,031. Theo Macklin và cs, (2002) và Boonyanuwat và cs, (2006) haplotype B13 mẫn cảm với bệnh Marek và cúm gà, nhưng haplotype B13 chưa phát hiện thấy ở cả 3 quần thể gà Tre, gà H’Mông và gà Tè. Các haplotype có khả năng kháng bệnh như B21, B15, đều có ở 3 quần thể gà nghiên cứu, tuy nhiên tần số các haplo type này không cao, trong khi đó haplotype B13 mẫn cảm với bệnh không có ở cả trong ba quần thể, có thể là do số lượng cá thể nghiên cứu trong mỗi giống chưa lớn và cùng từ một quần thể. Liên kết alen R của gen Mx với alen B21 của gen BF2 Để tìm hiểu về mối liên kết gen giữa những alen có khả năng kháng bệnh của gen BF2 và Mx, chúng tôi xác đ ịnh số lượng cá thể đồng thời mang alen B21 và alen R trong mỗi giống gà. Từ 48 cá thể được giải trình tự nucleotid trong exon 2 của gen BF2, phát hiện được13 cá thể mang alen B21có khả năng kháng bệnh Marek và cúm gà. Trong 13 cá thể này có 11 cá thể mang đồng thời alen R của gen Mx có khả năng kháng virus. Kết quả trình bày trong Bảng 5. Bảng 5. Số cá thể đồng thời mang alen B21 gen BF2 và alen R gen Mx của các giống gà Giống gà Alen B21 của gen BF2 Alen R của gen Mx Tỷ lệ n. n n. % Gà Tre 16 6 4 66,66 Gà H’Mông 16 5 5 100 Gà Tè 16 2 2 100 Bảng 5 cho thấy, tỷ lệ những cá thể đồng thời mang alen B21gen BF2 và mang alen R gen Mx trên những cá thể mang alen B21 của các giống gà rất cao, dao động từ 66,66% - 100%. Kết quả cho thấy khả năng có mối liên kết chặt chẽ giữa các alen có khả năng kháng virus của hai gen BF2 và Mx của các giống gà. Có thể đây là cơ sở khoa học để phân lập những cá thể gà mang những alen có khả năng kháng được virus. KẾT LUẬN Tần số alen R kháng virus của gen Mx ở các giống gà Tre, gà H’Mông và gà Tè tương ứng là 0,45; 0,58 và 0,48. Tần số kiểu gen Mx đồng hợp tử RR của các giống gà Tre, gà H’Mông và gà Tè tương ứng là 0,22; 0,35 và 0,10. 77
  8. VIỆN CHĂN NUÔI - Tạp chí Khoa học Công nghệ Chăn nuôi - Số 20-Tháng 10-2008 Đã phân lập được 16 haplotype của gen BF2 ở các giống gà Tre, gà H’Mông và gà Tè, trong đó có 8 haplotype đ ặc trưng cho ba giống gà trên. Trong số 8 haplotype đặc trưng trên, gà Tre, gà H’Mông và gà Tè có số haplotype tương ứng là 6; 5 và 3. Tỷ lệ của những cá thể mang đồng thời alen B21 gen BF2 và alen R gen Mx trên những cá thể mang alen B21 của ba giống gà rất cao, dao động từ 66,66 - 100%. Có mối liên kết giữa hai alen B21 và R có khả năng kháng virus của hai gen BF2 và Mx ở cả ba giống gà. TÀI LIỆU THAM KH ẢO Bacon. L.D, (1987): ” Influence of the Majorhistocompatibility complex on disease resistance and productivity.” Poultry Science 66. p. 802 - 811. Boonyanuwat.K, Sawat Thummabutra, Neramit Sookanee, Voravit Vatchavalkhu and Voravit Siripholvat, (2006): “Influences of major histocompatibility complex class I haplotypes on avian influenza virus disease traits in Thai indigenous chickens.”Animal Science Journal 77. p.285 - 289 Ewald.S.J., Ye X, Avendano S, McLeod S, Lamont S.L and Dekkers C.M, (2006):” association of BF2 alleles with antibody titre and production traits in commercial pure line broiler chickens.” Animal Genetics 38:p.174 - 176. Goto. R. M., M. Afanassieff, J. Ha, G. M. Iglesias, S. J. Ewald, W. E. Briles, and M. M. Miller, (2002) “Single- Strand Conformation Polymorphism (SSCP) Assays for Major Histocompatibility Complex B Genotyping in Chickens”. Poultry Science 81: p.1832 - 1841 Ko. J.H, Hee-Kyung Jin, Atsushi Asano, Ayato Takada, Ai Ninomiya, Hiroshi Kida, Hironao Hokiyama, Mutsuo Ohara, Masaoki Tsuzuki, Masahide, Nishibori, Makoto Mizutani and Tomomasa Watanabe, (2002) “Polymorphisms and the Differential Antiviral Activity of the Chicken Mx Gene” Genome Res. 12: p. 595 - 601. Ko. J.H, A. Takada, T. Mitsuhashi, T. Agui and T. Watanabe, (2004) ” Native antiviral specificity of chicken Mx protein depends on amino acid variation at position 631.” Animal Genetics . 35: p.119-122. Li.L,.Johnson.W and S.J. Ewald, (1997) ” Molecular characterization of major histocompatibility complex (B) haplotypes in broiler chickens.”Anim. Genet. 28 (4): p. 258 - 267. Li.C.Q, Lu L.Z, Shen J.D, Tao Z.R, Zhao A.Z, Yuan A.P, (2006) ” Advance in association studies of major histocompatibility complex (MHC) gene polymorphisms with traits of resistance against infectious disease in chicken.: Yi Chuan Jul.28 (7): p. 893 - 898. Li. X.Y, L. J. Qu, J. F. Yao, and N. Yang, (2006) ” Skewed Allele Frequencies of an Mx Gene Mutation with Potential Resistance to Avian Influenza Virus in Different Chicken Populations”. Poultry Science 85: p.1327 - 1329. Macklin. K.S, Ewald S.J.,. Norton R.A, (2002) ” Major histocompatibility complex effect on cellutitis among different chicken lines.” Avian pathology 31: p. 371 - 376. Seyama.T, J. H. Ko, M. Ohe, N. Sasaoka, A. Okada, H. Gomi,A. Yoneda, J. Ueda, M. Nishibori, S. Okamoto,Y. Maeda and T. Watanabe, (2006) “Population Research of Genetic Polymorphism at Amino Acid Position 631 in Chicken Mx Protein with Differential Antiviral Activity.”Biochemical Genetics volume 44 (No.9/10) p. 437 - 447. Wallny.H, Avila.D, Hunt.G., Powell.T.J., Riegert.P.,Salomonsen.J., Skjodt.K., Vainio.O., Vilbois.F.,Wiles.M.V and Kaufman.J, (2006) ” Peptide motifs of the single dominantly expressed class I molecule explain the striking MHC-determined response to Rous sarcoma virus in chickens”.Proc. Natl. Acad. Sci. U.S.A. 103 (5), p.1434 - 1439 *Người phản biện: TS. Nhữ văn Thụ ; Ths. Phạm Doãn Lân 78
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2